Hybridization Conditions and Melting Temperature

Stringency is a term that many molecular technologists are all very familiar with. It is a term that describes the combination of conditions under which a target is exposed to the probe. Typically, conditions that exhibit high stringency are more demanding of probe to target complementarity and length. Low stringency conditions are much more forgiving.

  • If conditions of stringency are too HIGH → Probe doesn’t bind to the target
  • If conditions of stringency are too LOW → Probe binds to unrelated targets

 

Important Factors That Affect Stringency and Hybridization

  • Temperature of hybridization and salt concentration
    • Increasing the hybridization temperature or decreasing the amount of salt in the buffer increases probe specificity and decreases hybridization of the probe to sequences that are not 100% the same.
  • Concentration of the denaturant in the buffer
    • For example: Deionized Formamide and SDS can be used to reduce non-specific binding of the probe
  • Length and nature of the probe sequence
STRINGENCY AND BINDING
– Long Probe

 

– Probe has increased number of G and C bases

 

Binding occurs under more stringent conditions
– Short Probe

 

– Probe has increased number of A and T bases

 

Binding occurs under less stringent conditions

Melting Temperature (Tm) Long Probes

  • The ideal hybridization conditions are estimated from the calculation of the Tm.
  • The Tm of the probe sequence is a way to express the amount of energy required to separate the hybridized strands of a given sequence.
  • At the Tm: Half of the sequence is double stranded and half of the sequence is single stranded.
  • Tm = 81.5°C + 16.6logM + 0.41(%G+C) – 0.61(%formamide) – (600/n)

Where M = Sodium concentration in mol/L

n = number of base pairs in smallest duplex

  • If we keep in mind that RNA is single stranded (ss) and DNA is double stranded (ds), then the following must be true:

 

RNA : DNA Hybrids   More stable

DNA : RNA Hybrids        ↓

DNA : DNA Hybrids    Less stable

 

  • Tm of RNA probes is higher, therefore RNA : DNA hybrids increase the Tm by 20 – 25°C

 

Calculating the Tm for Short Probes (14 – 20 base pairs)

  • Tm = 4°C x number of G/C pairs + 2°C x number of A/T pairs
  • The hybridization temperature (annealing temp) of oligonucleotide probes is approximately 5°C below the melting temperature.

melt-temp

Sequence Complexity (Cot)

  • Sequence complexity refers to the length of unique, non-repetitive nucleotide sequences.
  • Cot = Initial DNA Concentration (Co) x time required to reanneal it (t)
  • Cot1/2 = Time required for half of the double-stranded sequence to anneal under a given set of conditions.
  • Short probes can hybridize in 1 – 2 hours, where long probes require more time.

 

Test Your Knowledge

  1. Calculate the melting temperature of the DNA sequence below:

ATCTGCGAAATCAGTCCCGG
TAGACGCTTTAGTCAGGGCC

 

Answer
If the number of G/C pairs = 11, and the number of A/T pairs = 9. The calculation is as follows:
4(11) + 2(9) = X
X = 62°C

L Noll Image_small

-LeAnne Noll, BS, MB(ASCP)CM is a molecular technologist in Wisconsin and was recognized as one of ASCP’s Top Five from the 40 Under Forty Program in 2015.

 

One thought on “Hybridization Conditions and Melting Temperature”

  1. What about dna rna hybrids? would that formula for short probes work for a 22nt long dna rna hybrid? I mean instead of AT pairs in the formula can I just count AU pairs and calculate my tm?

    Also some places mention hybridization temperature to be like 20 to 25 degrees lower than tm and some (like you) say the difference is around 5 degrees. Why so? Can you please explain?

Leave a comment

This site uses Akismet to reduce spam. Learn how your comment data is processed.

Why are you reporting this comment?

Report type