Tag: hybridization

Hybridization Conditions and Melting Temperature

Stringency is a term that many molecular technologists are all very familiar with. It is a term that describes the combination of conditions under which a target is exposed to the probe. Typically, conditions that exhibit high stringency are more demanding of probe to target complementarity and length. Low stringency conditions are much more forgiving.

  • If conditions of stringency are too HIGH → Probe doesn’t bind to the target
  • If conditions of stringency are too LOW → Probe binds to unrelated targets

 

Important Factors That Affect Stringency and Hybridization

  • Temperature of hybridization and salt concentration
    • Increasing the hybridization temperature or decreasing the amount of salt in the buffer increases probe specificity and decreases hybridization of the probe to sequences that are not 100% the same.
  • Concentration of the denaturant in the buffer
    • For example: Deionized Formamide and SDS can be used to reduce non-specific binding of the probe
  • Length and nature of the probe sequence
STRINGENCY AND BINDING
– Long Probe

 

– Probe has increased number of G and C bases

 

 Binding occurs under more stringent conditions
– Short Probe

 

– Probe has increased number of A and T bases

 

 Binding occurs under less stringent conditions

Melting Temperature (Tm) Long Probes

  • The ideal hybridization conditions are estimated from the calculation of the Tm.
  • The Tm of the probe sequence is a way to express the amount of energy required to separate the hybridized strands of a given sequence.
  • At the Tm: Half of the sequence is double stranded and half of the sequence is single stranded.
  • Tm = 81.5°C + 16.6logM + 0.41(%G+C) – 0.61(%formamide) – (600/n)

Where M = Sodium concentration in mol/L

n = number of base pairs in smallest duplex

  • If we keep in mind that RNA is single stranded (ss) and DNA is double stranded (ds), then the following must be true:

 

RNA : DNA Hybrids   More stable

DNA : RNA Hybrids        ↓

DNA : DNA Hybrids    Less stable

 

  • Tm of RNA probes is higher, therefore RNA : DNA hybrids increase the Tm by 20 – 25°C

 

Calculating the Tm for Short Probes (14 – 20 base pairs)

  • Tm = 4°C x number of G/C pairs + 2°C x number of A/T pairs
  • The hybridization temperature (annealing temp) of oligonucleotide probes is approximately 5°C below the melting temperature.

melt-temp

Sequence Complexity (Cot)

  • Sequence complexity refers to the length of unique, non-repetitive nucleotide sequences.
  • Cot = Initial DNA Concentration (Co) x time required to reanneal it (t)
  • Cot1/2 = Time required for half of the double-stranded sequence to anneal under a given set of conditions.
  • Short probes can hybridize in 1 – 2 hours, where long probes require more time.

 

Test Your Knowledge

  1. Calculate the melting temperature of the DNA sequence below:

ATCTGCGAAATCAGTCCCGG
TAGACGCTTTAGTCAGGGCC

 

Answer
If the number of G/C pairs = 11, and the number of A/T pairs = 9. The calculation is as follows:
4(11) + 2(9) = X
X = 62°C

L Noll Image_small

-LeAnne Noll, BS, MB(ASCP)CM is a molecular technologist in Wisconsin and was recognized as one of ASCP’s Top Five from the 40 Under Forty Program in 2015.